feuC [2018-04-24 10:38:32]

ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

Locus: BSU01610

Isoelectric point: 10.44

Molecular weight: 42.91 kDa

Protein length: 394 aa

Gene length: 1182 bp

Function: acquisition of iron

Product: ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of iron/ siderophores
• Cellular processes → Homeostasis → Acquisition of iron → ABC transporters for the uptake of iron/ siderophores
• Metabolism → Additional metabolic pathways → Iron metabolism → ABC transporters for the uptake of iron/ siderophores
• Groups of genes → Membrane proteins

Gene

Coordinates: 180,344 → 181,354

The protein

Protein family

• FecCD subfamily (according to Swiss-Prot)

Paralogous protein(s)

• FhuG

Structure

• 4G1U (heme transporter from Yersinia pestis, 33% identity) PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: feuA-feuB-feuC-ybbA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon
  • Btr: activation, in the presence of the co-activators bacillibactin or enterobactin PubMed, in Btr regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
  • induced by iron starvation (second wave to allow iron scavenging from the environment) (Fur) PubMed
  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

  Additional information

  • the presence of an iron-responsive element bound by CitB between feuA and feuB suggests iron-dependent regulation by CitB PubMed

Other regulations

• CitB: translation control,

Biological materials

Mutant

• BKE01610 (ΔfeuC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAGCGATGAACAATGCAT, downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA
• BKK01610 (ΔfeuC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAGCGATGAACAATGCAT, downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA

References

Loading